How to figure out if a given DNA sequence is conserved through evolution?

4 posts / 0 new
Last post
kb03y
kb03y's picture
How to figure out if a given DNA sequence is conserved through evolution?

Hello.

I have a problem. I have been given a DNA sequence in fasta format and I am to find out if it is conserved through evolution. I just can't figure out a way to do this from the top of my head. The sequence in question is:

>DNA fragment
TCAGGGGCATCAAGAAAACAGATGAGGGTACTTACCGCTGTGAGGGCAGGATCCTGGCCCGCGGGGAAATCAACTTCAA
GGACATTCAGGTCATTGTGAATGTACCACCCACTGTCCAGGCCAGACAGAGCATCGTGAATGCCACTGCCAACCTGGGC
CAGTCTGTCACCCTGGTGTGTGATGCCGATGGCTTCCCAGAGCCCACCATGAGCTGGACAAAGGATGGGGAACCCATAG
AGAACGAGGAGGAAGATGACGAGAAGCACATCTTCAGTGATGACAGCTCCGAGCTGACCATCAGGAATGTGGATAAAAA
CGACGAGGCCGAATACGTCTGCATCGCAGAGAACAAGGCTGGCGAGCAGGATGCCTCCATCCA

Thanks in advance.

raunakms
raunakms's picture
You must be clear about two

You must be clear about two things. You want just the nucleotide sequence to be conserved or you want functional character conserved through the evolution.

If you are looking only for simple nucleotide sequence then you can BLAST the sequence (or use FASTA). Look at the sequence homology across species.

Also remember that the protein sequences are more conserved than the nucleotide sequences themselves. So for functional sequence conservation, you’d better run your sequence in tBLASTx that quires the translated protein sequences with translated sequence database and look for the sequence homology across species.

Regards
Raunak Shrestha

Biju
Biju's picture
Hi

Hi
You could also run blastn if you are interested in knowing conservation of a short sequence( 15-20 bases) for which you found out nucleotide substitutions and hence wants to know the conservation across species.
Biju Joseph

Nikail Collins
Nikail Collins's picture
conserved through evolution

Hi, I agree, the first step is to compare your nucleotide sequence of interest to those already in NCBI by using Blast. I would start at the nucleotide level since that is what you are given.  Hopefully, you will find some matches (good homology) so that you can start to determine which sequences you want to  include in further phylogenetic analysis which will help determine the question of evolution. Hope this helps!